Doxxing Megamind’s Genetic Sequence
linux > windows Megamind is unattractive 142.234.12.73 ATGCTCTTAGGTCTAGATCTATGGAACTCATCG trans rights 1 Award Did you just doxx his genetic sequence
A dark-mode Reddit comment thread jokes about Megamind being unattractive, followed by an IP address and a string of DNA-like letters. Another commenter asks whether someone just doxxed his genetic sequence, turning the fictional character’s appearance into a mock cybersecurity and genetics incident. It is sent as an absurd reaction to sharing an overly specific or invasive detail about someone. EN: A dark-mode Reddit comment thread jokes about Megamind being unattractive, followed by an IP address and a string of DNA-like letters. Another commenter asks whether someone just doxxed his genetic sequence, turning the fictional character’s appearance into a mock cybersecurity and genetics incident. It is sent as an absurd reaction to sharing an overly specific or invasive detail about someone.
- @eternalclassic / 33228 2023-05-26
- Type
- image
- Size
- 712×707 · 32.9 KiB
- Mood
- absurd, sarcastic
- Language
- en
- Added