Hidden Annotations In DNA
Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It Will Terrify You human_7605232288.exe File Edit Help //made he mouth way too big lmao //im leavin it in LOL CGTAGCTAGTCATGCAGATGGTATGGT CCTTA GAAATCGCCGTTGGGCAGAAATTTATCCGGAG //this guy is gonna be so DUMB CCGTTACGCTTGATGATATGGTGGAGTGCCGT GAATCGCCGAAGTAGCCTTGGGTCCGATCGAT AAGTCCTAGTGCGTATACAGGTTTCCCGCGTA //im just put some baboon code in here n see what happens CGAGTGCTGATCGTGGTAATTGTCGGTCAT //spent 7 hours writing this part just to fuck up his toes CCGTTTAGCGGTGAGCGAGTTGCGATTCGTGA GGTGGAGTCGAGTGGGTGAGCGTAGGCGTAGC
A fake scientific headline claims that scientists discovered terrifying hidden annotations in DNA. Below it, a retro computer window shows a programmer inserting silly comments and random-looking genetic code, joking that human DNA was written by an incompetent programmer who made mistakes. It is shared as an absurd science reaction meme about biological design and coding errors. EN: A fake scientific headline claims that scientists discovered terrifying hidden annotations in DNA. Below it, a retro computer window shows a programmer inserting silly comments and random-looking genetic code, joking that human DNA was written by an incompetent programmer who made mistakes. It is shared as an absurd science reaction meme about biological design and coding errors.
- @sbunem / 115526 2025-10-15
- Type
- image
- Size
- 800×800 · 118.3 KiB
- Mood
- absurd, satirical
- Language
- en
- Added
